|
1
|
|
Sector
|
Security Services Tenders
|
Tender Value
|
N.A.
|
|
Location
|
Maharashtra Tenders
|
Ref.No
|
71783728
|
|
Closing Date
|
20 - Jun - 2024
|
22 Days to go
|
View Tender Details
|
|
Supply of Erba Glucose Reagent, Erba Cholesterol Reagent, Erba Trigluceride, Erba Bilirubin Total, Erba Bilirubin Direct, Erba SGPT, Erba SGOT, Erba Alkline Phasphate, Erba Urea BUN, Microtips 200 Microleter, Erba Uric Acid, Erba H 360 Lyse, HbA1c, Dengue Kit, Malaria kit, Erba HDL Reagent, Pregnancy Kit, Erba Creatinine, Test Tube 12x75, Urine Container, Trop T Test, Tab Zerodol P, Tab Onecan 150, Tab Zerodol SP, Tab Telma 20, Tab Telma H, Syp Augmentin, Syp Montec LC, Tab Supradyn, Syp Flexon 60 ml, Syp Oricitral, Syp Colimex, Syp Digene, Tab Digene, Eye Drop Ciplox, Eye Drop Ciplox D, Dispovan 2 cc, Dispovan 5 cc, Volini Spray, Guaze Than, Inj Paracetamol 100 ml, Rolled Bandage 15 cm, Catgut, Betadine Lotion 500 ml - STC BSF Hospital Chakur Lab Sundries Items Qty : 12492
|
|
|
|
2
|
|
Sector
|
Security Services Tenders
|
Tender Value
|
N.A.
|
|
Location
|
Maharashtra Tenders
|
Ref.No
|
72320706
|
|
Closing Date
|
18 - Jun - 2024
|
20 Days to go
|
View Tender Details
|
|
Supply Of Alkaline Phosphate Small System Pack 5x22ml Per 5x6 8ml, Amylase Small System Pack 5 11ml, Bilirubin Direct Small System Pack 5x22ml Per 5x6 8ml, Bilirubin Total Small System Pack 5x22ml Per 5x6 8ml, Calcium A Small System Pack 5x6ml, Cholesterol System Small Pack 5x11ml, Control H Aso Rf Crp 1x1ml, Control L Aso Rf Crp 1x1ml, Cretinine Enzymatic 5x10ml Per 5x10ml, Erba Autowash System Pack 10x10ml, Erba Norm 4x5ml, Erba Path 4x5ml, Gamma Gt Small System Pack 2x22ml Per 2x6 8ml, Glucose God Pod 10x44ml, Hdl Cholesterol With Calibrator 4x30ml Per 4x10ml, Ldl Cholesterol With Calibrator 2x30ml Per 2x10ml, Sgot Hl Small System Pack 5x22ml Per 5x11 7ml, Sgpthl Small System Pack 5x22ml Per 5x11 7ml, Total Protein Small System Pack 5x6ml, Triglyceride Small System Pack 5x11ml Per 5x4ml, Urea Small System Pack 5x22ml Per 5x6 8ml, Uric Acid Small System Pack 5x11ml Per 5x4ml, Xl Autowash Ac Al Kit 5x44ml Per 5x44ml, Xl Multical 4x3ml, Sample Cup For Use In Calibration - Boq Lab Reagents Qty : 146
|
|
|
|
3
|
|
Sector
|
Security Services Tenders
|
Tender Value
|
N.A.
|
|
Location
|
Maharashtra Tenders
|
Ref.No
|
72300550
|
|
Closing Date
|
17 - Jun - 2024
|
19 Days to go
|
View Tender Details
|
|
Supply of Cleanzer Reagent, glucose kit, triglyceride Kit, Cholesterol kit, urea Kit, creatinine kit, Uric acid kit, direct bilirubin kit, TBI Kit, SGOT KIT, SGPT KIT, HDL kit, LDL kit, HbA1C kit, Amylase, Alkaline phosphate, Calcium, CRP, Albumin, Total protein, Bionorm, Biopath, Biocal - Reagent for Meril AQ 200 Fully Automated Biochemistry Analyser. Qty : 115
|
|
|
|
4
|
|
Sector
|
Education And Research Institute Tenders
|
Tender Value
|
 9.08 Lakh
|
|
Location
|
Maharashtra Tenders
|
Ref.No
|
72244021
|
|
Closing Date
|
14 - Jun - 2024
|
16 Days to go
|
View Tender Details
|
|
Supply of N5751-5g L-name 5gm Nw-nitro- L-arginine Methyl Ester Hydrochloride, 1610377 Precision Plus Protein Dual Xtra Prestained Protein Standards 500ul, E-el-r0026 Rat Leutinizing Hormone Lh Elisa Kit 96 Tests, E-el-r0391 Rat Follicle Stimulating Hormone Fsh Elisa Kit 96 Tests, E- El-0154 Progesterone Elisa Kit 96 Tests, E-el-r3006 Rat Prolactin Hormone Prl Elisa Kit 96 Kit, P034-100r Salsa Mlpa P034 Dmd-1 Probe Mix 100 Reactions, P035-100r Salsa Mlpa P035 Dmd-2 Probe Mix 100 Reactions, Ek1- Fam Salsa Mlpa Ek1 Reagent Kit 100 Reactions 6 Vials 100 Reactions -fam, 07j68-001 Thermobrite Humidity Strips, A12216 Amplex Red Cholestrol, A22189 Amplex Red Glucose 1gu, A12221 Amplex Red Glutamic Ac, A22188 Amplex Red Hydrogen Pe, A33855 Amplex Red Ultra Red Stop Reagent, Q32856 Qubit Assay Tubes Set of 500, Custom Morpholino 5ctccagcccagtctgcccatcgag3 Carboxyfluorescein 300nmol, Standard Control Oligo - 3 Fluorescein 300nmol, Ek-075-40 Leap-2 38-77 Elisa Kit, Mb228-500ml, 61808 Pyridine 500ml - Consumables Kits for Medical Research Misc1. Qty : 45
|
|
|
|
|
|
|
|
|
|
|
|
9
|
|
Sector
|
Security Services Tenders
|
Tender Value
|
4.68 Million approx. / 46.86 Lakh approx.
|
|
Location
|
Maharashtra Tenders
|
Ref.No
|
72047624
|
|
Closing Date
|
06 - Jun - 2024
|
8 Days to go
|
View Tender Details
|
|
Supply of Ultra view DAB, Bluing Reagent, Hematoxylin, Reaction Buffer, LCS, EZ prep, CCI, Anti HER 2 oblique NEU 4B5, PMS2 A16 4, MSH6 SP93, MLH1 M1, MSH2 G219 to 1129, P 16, Ventana HER2 DISH DNA PRB CKT - CONSUMABLES FOR AUTOMATED IHC STAINER Qty : 293
|
|
|
|
10
|
|
Sector
|
Security Services Tenders
|
Tender Value
|
N.A.
|
|
Location
|
Maharashtra Tenders
|
Ref.No
|
72048161
|
|
Closing Date
|
06 - Jun - 2024
|
8 Days to go
|
View Tender Details
|
|
Supply of Whole Blood Body Fluid Dna Blood Mini Kit, Dna Bisulphate Modification Kit, Pyromark Pcr Kit, Pyromark Q48 Advanced Cp G Reagent, Pyromark Q 48 Magnetic Bead, Pyromark Q 48 Reagent Cartridge, Insulin Elisa Kit 96 Wel, Eppendrof Sample Storage Boxes, Barrier Tips 100ui, Barrier Tips 200ui, Barrier Tips 500ui - Procurment of Consumables for Anveshan Project Qty : 3430
|
|
|